First Report of Tar Spot on Orange Geiger, Cordia sebestena, Caused by Diatractium cordianum in Florida.

In July 2007, tar spot symptoms observed on citrus leaves Geiger, sebestena Cordia L. (boraginaceae), in the landscape and commercial nursery in Homestead, FL. This disease appears to be spreading and locally severe. Symptoms are circular, little spots hypertrophy of about 5 to 8 cm in diameter, slightly chlorotic on abaxial surface and has a lot of stromal blackened circular, 0.2-0.4 mm, on the lower surface of leaves. Old and yellowing leaves, the area around the fixed point of pale green.

Embedded in the stroma much Perithecia, 173-312 m diameter, circular to irregular in shape, with a neck that as many as 200 pM lateral length and 73-104 m in diameter. ASCI, 77-92 × 11 to 13 um, are elongated, two-celled ascospores, 50-61 × 3 to 5 um which have narrowing of the striking wall dividing cells. Dimensions and appearance of pathogens fits tightly with those published for Diatractium cordianum (Ellis & Kelsey) Syd (1). Young, asymptomatic C. sebestena leaves were sprayed to runoff with ascospores suspension of approximately 104 ml-1 were harvested from the affected leaves. inoculated leaves were placed on a paper towel saturated with water in petri dishes and kept in a growth chamber at 25 ° C with fluorescent light at 10 h day-1.

Symptoms similar to those observed in the affected trees in the landscape began to evolve after 21 days and Perithecia clear after 28 days. An ITS 1, 2 ITS and 5.8S rDNA sequences deposited in GenBank (Accession No. EU541488). A herbarium specimens deposited in the US National Fungus Collections (BPI No. 878 441). It is a new host record for D. cordianum and is the first time the pathogens have been reported in the United States. previous record comes from Venezuela and several Caribbean islands, including Cuba and Jamaica.

Symptoms of this disease has not been observed in Texas wild olive, Cordia boissieri, near exposed C. sebestena. P. F. Cannon (1) suggests that the disease has no economic impact. However, the striking nature of the C sebestena symptoms and the importance of this tree in South Florida ornamental trade (2) shows that this disease can be significant in the last host. References: (1) P. F. Cannon. Mycol. Res. 92: 327, 1989. (2) D. E. F. G. Gilman and Watson

 First Report of Tar Spot on Orange Geiger, Cordia sebestena, Caused by Diatractium cordianum in Florida.
First Report of Tar Spot on Orange Geiger, Cordia sebestena, Caused by Diatractium cordianum in Florida.

Randomized, controlled clinical pilot study of venous leg ulcers treated with two types of shockwave therapy.

Background. Venous leg ulcers difficult to heal wounds. The basis of their physiotherapeutic treatment is compression therapy. However, over the years, looking for additional or other methods to supplement the treatment of venous ulcers, which would shorten the duration of treatment, are ongoing. One such method is shockwave therapy.

Method. The aim of our study was to compare radial shockwave therapy (R-ESWT) with a focused shockwave therapy (F-ESWT) in the treatment of venous leg ulcers. Patients were randomly assigned to a group of trees. In the first group of radial shockwave therapy (0.17mJ / mm2, 100 impulses / cm2, 5 Hz), the second group focused shockwave therapy (0.173mJ / mm2, 100 impulses / cm2, 5 Hz) is used and in the third group used a standard treatment. Patients in the shockwave therapy group were given 6 treatments at intervals of five days.

Total area, circumference, Gilman index, maximum length and maximum width of the ulcer was measured. The third group of patients with wet gauze dressing with salt and gently compressing the elastic bandage used (SWC standard wound care).

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Hu-96T 96T
EUR 621
  • Should the Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Mu-48T 48T
EUR 450
  • Should the Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Mu-96T 96T
EUR 582
  • Should the Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Ra-48T 48T
EUR 508
  • Should the Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Ra-96T 96T
EUR 661
  • Should the Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Hu-48Tests 48 Tests
EUR 500

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Hu-96Tests 96 Tests
EUR 692

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Mu-48Tests 48 Tests
EUR 465

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Mu-96Tests 96 Tests
EUR 643

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Ra-48Tests 48 Tests
EUR 534

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Ra-96Tests 96 Tests
EUR 742

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Hu-48Tests 48 Tests
EUR 478

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Hu-96Tests 96 Tests
EUR 662

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Mu-48Tests 48 Tests
EUR 446

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Mu-96Tests 96 Tests
EUR 615

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Ra-48Tests 48 Tests
EUR 511

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Ra-96Tests 96 Tests
EUR 709

Bid/ Rat Bid ELISA Kit

ELA-E0629r 96 Tests
EUR 886

Bid/ Rat Bid ELISA Kit

ELI-02234r 96 Tests
EUR 886

BID protein

30R-1173 100 ug
EUR 586
Description: Purified recombinant Human BID protein

Bid Antibody

24251-100ul 100ul
EUR 390

Bid Antibody

24252-100ul 100ul
EUR 390

Bid antibody

20R-1486 100 ug
EUR 673
Description: Rabbit polyclonal Bid antibody

Bid antibody

20R-2964 100 ul
EUR 393
Description: Rabbit polyclonal Bid antibody

BID Antibody

31037-100ul 100ul
EUR 252

BID Antibody

31037-50ul 50ul
EUR 187

Bid antibody

70R-11670 100 ug
EUR 403
Description: Rabbit polyclonal Bid antibody

Bid antibody

70R-11734 100 ug
EUR 403
Description: Rabbit polyclonal Bid antibody

BID antibody

70R-31114 100 ug
EUR 327
Description: Rabbit polyclonal BID antibody

BID antibody

70R-31344 100 ug
EUR 327
Description: Rabbit polyclonal BID antibody

BID antibody

70R-15995 50 ul
EUR 435
Description: Rabbit polyclonal BID antibody

Bid Antibody

EUR 316

Bid Antibody

EUR 146

Bid Antibody

EUR 316

Bid Antibody

EUR 146

BID Antibody

32014-100ul 100ul
EUR 252

BID antibody

10R-10974 100 ug
EUR 349
Description: Mouse monoclonal BID antibody

BID antibody

10R-1121 100 ul
EUR 316
Description: Mouse monoclonal BID antibody

Bid antibody

10R-8490 100 ul
EUR 393
Description: Mouse monoclonal Bid antibody

Bid antibody

10R-8491 100 ul
EUR 393
Description: Mouse monoclonal Bid antibody

Bid Antibody

49505-100ul 100ul
EUR 333

Bid Antibody

49505-50ul 50ul
EUR 239

Bid BH3

5-00760 4 x 1mg Ask for price

BID Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BID. Recognizes BID from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

BID Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

BID Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BID Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:1000-1:2000

BID Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:2000, IHC:1:25-1:100

BID Antibody

DF6016 200ul
EUR 304
Description: BID Antibody detects endogenous levels of total BID.

BID Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:2000, IHC:1:25-1:100

BID Antibody

BF0373 200ul
EUR 376
Description: BID antibody detects endogenous levels of total BID.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BID Antibody

ABD6016 100 ug
EUR 438


LF-PA0182 100 ul
EUR 334
Description: Rabbit polyclonal to Bid


PVTH0006 2 ug
EUR 470


YF-PA10477 100 ug
EUR 403
Description: Rabbit polyclonal to Bid

BID antibody (Ser78)

70R-31343 100 ug
EUR 327
Description: Rabbit polyclonal BID antibody (Ser78)

BID Rabbit pAb

A0728-100ul 100 ul
EUR 308

BID Rabbit pAb

A0728-200ul 200 ul
EUR 459

BID Rabbit pAb

A0728-20ul 20 ul Ask for price

BID Rabbit pAb

A0728-50ul 50 ul Ask for price

Bid Blocking Peptide

33R-10457 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Bid antibody, catalog no. 20R-1486

Bid Blocking Peptide

33R-10654 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Bid antibody, catalog no. 70R-11670

Bid Blocking Peptide

33R-10697 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Bid antibody, catalog no. 70R-11734

Bid Blocking Peptide

EUR 153

Bid Blocking Peptide

EUR 153

Bid BH3 Peptide

5-00761 4 x 1mg Ask for price

Bid BH3 - r8

5-00762 4 x 1mg Ask for price

Bid BH3 - r9

5-00763 4 x 1mg Ask for price

BID Blocking Peptide

DF6016-BP 1mg
EUR 195

Anti-Bid Antibody

A00730 100ug/vial
EUR 334

BID Rabbit pAb

A0210-100ul 100 ul
EUR 308

BID Rabbit pAb

A0210-200ul 200 ul
EUR 459

BID Rabbit pAb

A0210-20ul 20 ul
EUR 183

BID Rabbit pAb

A0210-50ul 50 ul
EUR 223

Bid (pS65) Antibody

abx031834-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Bid (pS65) Antibody

abx031834-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

BID Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Bid Conjugated Antibody

C49505 100ul
EUR 397

Polyclonal Bid Antibody

APG02272G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bid . This antibody is tested and proven to work in the following applications:

BID Conjugated Antibody

C32014 100ul
EUR 397

BID Conjugated Antibody

C31037 100ul
EUR 397

BID Blocking Peptide

BF0373-BP 1mg
EUR 195

BID cloning plasmid

CSB-CL002698HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggactgtgaggtcaacaacggttccagcctcagggatgagtgcatcacaaacctactggtgtttggcttcctccaaagctgttctgacaacagcttccgcagagagctggacgcactgggccacgagctgccagtgctggctccccagtgggagggctacgatgagctgcagac
  • Show more
Description: A cloning plasmid for the BID gene.

BID cloning plasmid

CSB-CL002698HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggactgtgaggtcaacaacggttccagcctcagggatgagtgcatcacaaacctactggtgtttggcttcctccaaagctgttctgacaacagcttccgcagagagctggacgcactgggccacgagctgccagtgctggctccccagtgggagggctacgatgagctgcagac
  • Show more
Description: A cloning plasmid for the BID gene.

BID Polyclonal Antibody

ABP50013-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human BID at AA range: 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human. This BID antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BID at AA range: 20-100

BID Polyclonal Antibody

ABP50013-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human BID at AA range: 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human. This BID antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BID at AA range: 20-100

BID Polyclonal Antibody

ABP50013-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human BID at AA range: 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human. This BID antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BID at AA range: 20-100

BID Polyclonal Antibody

ABP50770-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human BID around the non-phosphorylation site of S78
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human, Mouse. This BID antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human BID around the non-phosphorylation site of S78

BID Polyclonal Antibody

ABP50770-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human BID around the non-phosphorylation site of S78
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human, Mouse. This BID antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human BID around the non-phosphorylation site of S78

BID Polyclonal Antibody

ABP50770-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human BID around the non-phosphorylation site of S78
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human, Mouse. This BID antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human BID around the non-phosphorylation site of S78

BID Polyclonal Antibody

A55679 100 µg
EUR 570.55
Description: kits suitable for this type of research

BID Polyclonal Antibody

ES1769-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BID from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

BID Polyclonal Antibody

ES1769-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BID from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

BID Polyclonal Antibody

ES1012-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against BID from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

BID Polyclonal Antibody

ES1012-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against BID from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- BID antibody

FNab00892 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: BH3 interacting domain death agonist
  • Uniprot ID: P55957
  • Gene ID: 637
  • Research Area: Cancer, Signal Transduction, Metabolism, Cell Division and Proliferation
Description: Antibody raised against BID

anti- BID antibody

FNab00893 100µg
EUR 505.25
  • Recommended dilution: WB: 1:2000-1:10000
  • Immunogen: BH3 interacting domain death agonist
  • Uniprot ID: P55957
  • Gene ID: 637
  • Research Area: Cancer, Signal Transduction, Metabolism, Cell Division and Proliferation
Description: Antibody raised against BID

Anti-Bid Antibody

PA2015 100ug/vial
EUR 334

anti-Bid (8D2)

LF-MA0207 100 ul
EUR 334
Description: Mouse monoclonal to Bid

anti-Bid (21F10)

LF-MA0208 100 ul
EUR 334
Description: Mouse monoclonal to Bid

anti-BID (3C5)

LF-MA30561 100 ul
EUR 527
Description: Mouse Monoclonal to BID

Anti-BID antibody

PAab00892 100 ug
EUR 355

Recombinant mouse BID

P1006 100ug Ask for price
  • Uniprot ID: P70444
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse BID

Anti-Bid Antibody

PB9027 100ug/vial
EUR 334

pcDNA3.1-BID Plasmid

PVTB00401-2a 2 ug
EUR 356

Anti-BID antibody

STJ111018 100 µl
EUR 277
Description: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined.

Anti-BID antibody

STJ90016 200 µl
EUR 197
Description: Rabbit polyclonal to BID.

Anti-BID antibody

STJ91853 200 µl
EUR 197
Description: Rabbit polyclonal to BID.

Anti-Bid antibody

STJ22797 100 µl
EUR 277
Description: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined.

Anti-BID antibody

STJ70684 100 µg
EUR 359

Anti-BID antibody

STJ97864 100 µl
EUR 234
Description: Mouse monoclonal to BID.

BID, Human Recombinant

P1571-10 10 µg
EUR 156

BID, Human Recombinant

P1571-50 50 µg
EUR 551

Phospho-BID (Ser78) Antibody

EUR 403

BID Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BID Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BID Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-BID (S78) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BID (S78). Recognizes Phospho-BID (S78) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Human Bid ELISA Kit

EHB0313 96Tests
EUR 521


ELA-E0629h 96 Tests
EUR 824

Goat Bid ELISA Kit

EGTB0313 96Tests
EUR 521

Bovine Bid ELISA Kit

EBB0313 96Tests
EUR 521

Canine Bid ELISA Kit

ECB0313 96Tests
EUR 521

Chicken Bid ELISA Kit

ECKB0313 96Tests
EUR 521

Anserine Bid ELISA Kit

EAB0313 96Tests
EUR 521


EF007294 96 Tests
EUR 689

Rat BID shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BID shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BID shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bid recombinant monoclonal antibody

A5293 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Bid for WB, IHC,ELISA

Mouse Bid ELISA Kit

EMB0313 96Tests
EUR 521

Rat Bid ELISA Kit

ERB0313 96Tests
EUR 521

Sheep Bid ELISA Kit

ESB0313 96Tests
EUR 521

Rabbit Bid ELISA Kit

ERTB0313 96Tests
EUR 521

Monkey Bid ELISA Kit

EMKB0313 96Tests
EUR 521

Porcine Bid ELISA Kit

EPB0313 96Tests
EUR 521

pET29a-P15 BID Plasmid

PVT16101 2 ug
EUR 325


PVT16704 2 ug
EUR 325

Recombinant Human BID Protein

RP00021 5 μg
EUR 149

BID Recombinant Protein (Human)

RP003037 100 ug Ask for price

Results. Analysis of the results showed that a complete cure ulcer was achieved in 35% of patients treated with radial shockwave, 26% of patients with focused shock waves used