First Report of Tar Spot on Orange Geiger, Cordia sebestena, Caused by Diatractium cordianum in Florida.

In July 2007, tar spot symptoms observed on citrus leaves Geiger, sebestena Cordia L. (boraginaceae), in the landscape and commercial nursery in Homestead, FL. This disease appears to be spreading and locally severe. Symptoms are circular, little spots hypertrophy of about 5 to 8 cm in diameter, slightly chlorotic on abaxial surface and has a lot of stromal blackened circular, 0.2-0.4 mm, on the lower surface of leaves. Old and yellowing leaves, the area around the fixed point of pale green.

Embedded in the stroma much Perithecia, 173-312 m diameter, circular to irregular in shape, with a neck that as many as 200 pM lateral length and 73-104 m in diameter. ASCI, 77-92 × 11 to 13 um, are elongated, two-celled ascospores, 50-61 × 3 to 5 um which have narrowing of the striking wall dividing cells. Dimensions and appearance of pathogens fits tightly with those published for Diatractium cordianum (Ellis & Kelsey) Syd (1). Young, asymptomatic C. sebestena leaves were sprayed to runoff with ascospores suspension of approximately 104 ml-1 were harvested from the affected leaves. inoculated leaves were placed on a paper towel saturated with water in petri dishes and kept in a growth chamber at 25 ° C with fluorescent light at 10 h day-1.

Symptoms similar to those observed in the affected trees in the landscape began to evolve after 21 days and Perithecia clear after 28 days. An ITS 1, 2 ITS and 5.8S rDNA sequences deposited in GenBank (Accession No. EU541488). A herbarium specimens deposited in the US National Fungus Collections (BPI No. 878 441). It is a new host record for D. cordianum and is the first time the pathogens have been reported in the United States. previous record comes from Venezuela and several Caribbean islands, including Cuba and Jamaica.

Symptoms of this disease has not been observed in Texas wild olive, Cordia boissieri, near exposed C. sebestena. P. F. Cannon (1) suggests that the disease has no economic impact. However, the striking nature of the C sebestena symptoms and the importance of this tree in South Florida ornamental trade (2) shows that this disease can be significant in the last host. References: (1) P. F. Cannon. Mycol. Res. 92: 327, 1989. (2) D. E. F. G. Gilman and Watson

 First Report of Tar Spot on Orange Geiger, Cordia sebestena, Caused by Diatractium cordianum in Florida.
First Report of Tar Spot on Orange Geiger, Cordia sebestena, Caused by Diatractium cordianum in Florida.

Randomized, controlled clinical pilot study of venous leg ulcers treated with two types of shockwave therapy.

Background. Venous leg ulcers difficult to heal wounds. The basis of their physiotherapeutic treatment is compression therapy. However, over the years, looking for additional or other methods to supplement the treatment of venous ulcers, which would shorten the duration of treatment, are ongoing. One such method is shockwave therapy.

Method. The aim of our study was to compare radial shockwave therapy (R-ESWT) with a focused shockwave therapy (F-ESWT) in the treatment of venous leg ulcers. Patients were randomly assigned to a group of trees. In the first group of radial shockwave therapy (0.17mJ / mm2, 100 impulses / cm2, 5 Hz), the second group focused shockwave therapy (0.173mJ / mm2, 100 impulses / cm2, 5 Hz) is used and in the third group used a standard treatment. Patients in the shockwave therapy group were given 6 treatments at intervals of five days.

Total area, circumference, Gilman index, maximum length and maximum width of the ulcer was measured. The third group of patients with wet gauze dressing with salt and gently compressing the elastic bandage used (SWC standard wound care).

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Hu-48 1 kit of 48 tests
EUR 447.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human BH3 Interacting Domain Death Agonist (Bid)

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Hu-96 1 kit of 96 tests
EUR 597.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human BH3 Interacting Domain Death Agonist (Bid)

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Mu-192 1 kit of 192 tests
EUR 978.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse BH3 Interacting Domain Death Agonist (Bid)

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Mu-48 1 kit of 48 tests
EUR 421.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse BH3 Interacting Domain Death Agonist (Bid)

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Mu-96 1 kit of 96 tests
EUR 559.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse BH3 Interacting Domain Death Agonist (Bid)

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Ra-192 1 kit of 192 tests
EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat BH3 Interacting Domain Death Agonist (Bid)

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Ra-48 1 kit of 48 tests
EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat BH3 Interacting Domain Death Agonist (Bid)

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DL-Bid-Ra-96 1 kit of 96 tests
EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat BH3 Interacting Domain Death Agonist (Bid)

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Hu-48T 48T
EUR 479.00
  • Should the Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Hu-96T 96T
EUR 621.00
  • Should the Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Mu-48T 48T
EUR 450.00
  • Should the Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Mu-96T 96T
EUR 582.00
  • Should the Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Ra-48T 48T
EUR 508.00
  • Should the Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

DLR-Bid-Ra-96T 96T
EUR 661.00
  • Should the Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat BH3 Interacting Domain Death Agonist (Bid) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Hu-48Tests 48 Tests
EUR 500.00

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Hu-96Tests 96 Tests
EUR 692.00

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Mu-48Tests 48 Tests
EUR 465.00

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Mu-96Tests 96 Tests
EUR 643.00

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Ra-48Tests 48 Tests
EUR 534.00

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RDR-Bid-Ra-96Tests 96 Tests
EUR 742.00

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Hu-48Tests 48 Tests
EUR 478.00

Human BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Hu-96Tests 96 Tests
EUR 662.00

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Mu-48Tests 48 Tests
EUR 446.00

Mouse BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Mu-96Tests 96 Tests
EUR 615.00

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Ra-48Tests 48 Tests
EUR 511.00

Rat BH3 Interacting Domain Death Agonist (Bid) ELISA Kit

RD-Bid-Ra-96Tests 96 Tests
EUR 709.00

Bid/ Rat Bid ELISA Kit

ELI-02234r 96 Tests
EUR 886.00

Bid/ Rat Bid ELISA Kit

ELA-E0629r 96 Tests
EUR 886.00

BID Antibody

BF0373 200ul
EUR 376.00
Description: BID antibody detects endogenous levels of total BID.

BID Antibody

1-CSB-PA002698GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BID Antibody

1-CSB-PA002698HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:1000-1:2000

BID Antibody

1-CSB-PA000015
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

BID Antibody

1-CSB-PA000994
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BID. Recognizes BID from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

BID Antibody

1-CSB-PA787438
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:2000, IHC:1:25-1:100

BID Antibody

1-CSB-PA225375
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:2000, IHC:1:25-1:100

Bid antibody

20R-1486 100 ug
EUR 673.00
Description: Rabbit polyclonal Bid antibody

Bid antibody

20R-2964 100 ul
EUR 393.00
Description: Rabbit polyclonal Bid antibody

BID antibody

10R-10974 100 ug
EUR 349.00
Description: Mouse monoclonal BID antibody

BID antibody

10R-1121 100 ul
EUR 316.00
Description: Mouse monoclonal BID antibody

Bid antibody

10R-8490 100 ul
EUR 393.00
Description: Mouse monoclonal Bid antibody

Bid antibody

10R-8491 100 ul
EUR 393.00
Description: Mouse monoclonal Bid antibody

Bid Antibody

3272-100
EUR 316.00

Bid Antibody

3272-30T
EUR 146.00

Bid Antibody

3172-100
EUR 316.00

Bid Antibody

3172-30T
EUR 146.00

BID Antibody

32014-100ul 100ul
EUR 252.00

BID Antibody

31037-100ul 100ul
EUR 252.00

BID Antibody

31037-50ul 50ul
EUR 187.00

BID protein

30R-1173 100 ug
EUR 586.00
Description: Purified recombinant Human BID protein

Bid Antibody

24251-100ul 100ul
EUR 390.00

Bid Antibody

24252-100ul 100ul
EUR 390.00

Bid BH3

5-00760 4 x 1mg Ask for price

BID antibody

70R-31114 100 ug
EUR 327.00
Description: Rabbit polyclonal BID antibody

BID antibody

70R-31344 100 ug
EUR 327.00
Description: Rabbit polyclonal BID antibody

BID siRNA

20-abx900636
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BID siRNA

20-abx909104
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BID siRNA

20-abx909105
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BID Antibody

DF6016 200ul
EUR 304.00
Description: BID Antibody detects endogenous levels of total BID.

BID Antibody

ABD6016 100 ug
EUR 438.00

BID antibody

70R-15995 50 ul
EUR 435.00
Description: Rabbit polyclonal BID antibody

Bid antibody

70R-11670 100 ug
EUR 403.00
Description: Rabbit polyclonal Bid antibody

Bid antibody

70R-11734 100 ug
EUR 403.00
Description: Rabbit polyclonal Bid antibody

Bid Antibody

49505-100ul 100ul
EUR 333.00

Bid Antibody

49505-50ul 50ul
EUR 239.00

anti-Bid

LF-PA0182 100 ul
EUR 334.00
Description: Rabbit polyclonal to Bid

pDsRed2-Bid

PVTH0006 2 ug
EUR 470.00

anti-Bid

YF-PA10477 100 ug
EUR 403.00
Description: Rabbit polyclonal to Bid

Polyclonal Bid Antibody

APG02272G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Bid . This antibody is tested and proven to work in the following applications:

Bid Conjugated Antibody

C49505 100ul
EUR 397.00

BID Conjugated Antibody

C31037 100ul
EUR 397.00

BID Conjugated Antibody

C32014 100ul
EUR 397.00

BID Blocking Peptide

BF0373-BP 1mg
EUR 195.00

BID cloning plasmid

CSB-CL002698HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggactgtgaggtcaacaacggttccagcctcagggatgagtgcatcacaaacctactggtgtttggcttcctccaaagctgttctgacaacagcttccgcagagagctggacgcactgggccacgagctgccagtgctggctccccagtgggagggctacgatgagctgcagac
  • Show more
Description: A cloning plasmid for the BID gene.

BID cloning plasmid

CSB-CL002698HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atggactgtgaggtcaacaacggttccagcctcagggatgagtgcatcacaaacctactggtgtttggcttcctccaaagctgttctgacaacagcttccgcagagagctggacgcactgggccacgagctgccagtgctggctccccagtgggagggctacgatgagctgcagac
  • Show more
Description: A cloning plasmid for the BID gene.

Bid Blocking Peptide

33R-10457 50 ug
EUR 349.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Bid antibody, catalog no. 20R-1486

Bid Blocking Peptide

33R-10654 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Bid antibody, catalog no. 70R-11670

Bid Blocking Peptide

33R-10697 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Bid antibody, catalog no. 70R-11734

Bid Blocking Peptide

3272BP-50
EUR 153.00

Bid Blocking Peptide

3172BP-50
EUR 153.00

Bid BH3 Peptide

5-00761 4 x 1mg Ask for price

Bid BH3 - r8

5-00762 4 x 1mg Ask for price

Bid BH3 - r9

5-00763 4 x 1mg Ask for price

BID Polyclonal Antibody

A55679 100 µg
EUR 570.55
Description: kits suitable for this type of research

BID antibody (Ser78)

70R-31343 100 ug
EUR 327.00
Description: Rabbit polyclonal BID antibody (Ser78)

Bid (pS65) Antibody

abx031834-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Bid (pS65) Antibody

abx031834-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

BID Blocking Peptide

20-abx061668
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

BID Polyclonal Antibody

ABP50770-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from human BID around the non-phosphorylation site of S78
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human, Mouse. This BID antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human BID around the non-phosphorylation site of S78

BID Polyclonal Antibody

ABP50770-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from human BID around the non-phosphorylation site of S78
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human, Mouse. This BID antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human BID around the non-phosphorylation site of S78

BID Polyclonal Antibody

ABP50770-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from human BID around the non-phosphorylation site of S78
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human, Mouse. This BID antibody is for WB , IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human BID around the non-phosphorylation site of S78

BID Polyclonal Antibody

E-AB-30014-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: The major proteolytic product p15 BID allows the release of cytochrome c (By similarity). Is
  • Show more
Description: Rabbit antibody against Human BID for WB,ELISA applications.

BID Polyclonal Antibody

E-AB-30014-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: The major proteolytic product p15 BID allows the release of cytochrome c (By similarity). Is
  • Show more
Description: Rabbit antibody against Human BID for WB,ELISA applications.

BID Polyclonal Antibody

E-AB-30014-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide,0.5% BSA and 50% glycerol pH 7.4.
  • Purified by: Affinity purification
  • Background: The major proteolytic product p15 BID allows the release of cytochrome c (By similarity). Is
  • Show more
Description: Rabbit antibody against Human BID for WB,ELISA applications.

BID Polyclonal Antibody

E-AB-30648-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The major proteolytic product p15 BID allows the release of cytochrome c (By similarity). Is
  • Show more
Description: Rabbit antibody against Human,Mouse BID for WB,IHC-p,ELISA applications.

BID Polyclonal Antibody

E-AB-30648-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The major proteolytic product p15 BID allows the release of cytochrome c (By similarity). Is
  • Show more
Description: Rabbit antibody against Human,Mouse BID for WB,IHC-p,ELISA applications.

BID Polyclonal Antibody

E-AB-30648-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.02% sodium azide, 0.5% BSA and 50% glycerol, pH7.4
  • Purified by: Affinity purification
  • Background: The major proteolytic product p15 BID allows the release of cytochrome c (By similarity). Is
  • Show more
Description: Rabbit antibody against Human,Mouse BID for WB,IHC-p,ELISA applications.

BID Polyclonal Antibody

E-AB-10182-120uL 120uL
EUR 257.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The en
  • Show more
Description: Rabbit antibody against Human BID for WB,IHC,ELISA applications.

BID Polyclonal Antibody

E-AB-10182-20uL 20uL
EUR 130.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The en
  • Show more
Description: Rabbit antibody against Human BID for WB,IHC,ELISA applications.

BID Polyclonal Antibody

E-AB-10182-60uL 60uL
EUR 175.00
  • Conjugation: Unconjugated
  • Buffer composition: PBS with 0.05% sodium azide, 50% glycerol, PH7.3
  • Purified by: Affinity purification
  • Background: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The en
  • Show more
Description: Rabbit antibody against Human BID for WB,IHC,ELISA applications.

BID Blocking Peptide

DF6016-BP 1mg
EUR 195.00

BID Rabbit pAb

A0210-100ul 100 ul
EUR 308.00

BID Rabbit pAb

A0210-200ul 200 ul
EUR 459.00

BID Rabbit pAb

A0210-20ul 20 ul
EUR 183.00

BID Rabbit pAb

A0210-50ul 50 ul
EUR 223.00

BID Rabbit pAb

A0728-100ul 100 ul
EUR 308.00

BID Rabbit pAb

A0728-200ul 200 ul
EUR 459.00

BID Rabbit pAb

A0728-20ul 20 ul Ask for price

BID Rabbit pAb

A0728-50ul 50 ul Ask for price

Anti-Bid Antibody

A00730 100ug/vial
EUR 334.00

BID Polyclonal Antibody

ABP50013-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human BID at AA range: 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human. This BID antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BID at AA range: 20-100

BID Polyclonal Antibody

ABP50013-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human BID at AA range: 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human. This BID antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BID at AA range: 20-100

BID Polyclonal Antibody

ABP50013-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human BID at AA range: 20-100
  • Applications tips:
Description: A polyclonal antibody for detection of BID from Human. This BID antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human BID at AA range: 20-100

anti- BID antibody

FNab00892 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: BH3 interacting domain death agonist
  • Uniprot ID: P55957
  • Gene ID: 637
  • Research Area: Cancer, Signal Transduction, Metabolism, Cell Division and Proliferation
Description: Antibody raised against BID

anti- BID antibody

FNab00893 100µg
EUR 505.25
  • Recommended dilution: WB: 1:2000-1:10000
  • Immunogen: BH3 interacting domain death agonist
  • Uniprot ID: P55957
  • Gene ID: 637
  • Research Area: Cancer, Signal Transduction, Metabolism, Cell Division and Proliferation
Description: Antibody raised against BID

BID Polyclonal Antibody

ES1769-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against BID from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

BID Polyclonal Antibody

ES1769-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against BID from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

BID Polyclonal Antibody

ES1012-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against BID from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

BID Polyclonal Antibody

ES1012-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against BID from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti-Bid (8D2)

LF-MA0207 100 ul
EUR 334.00
Description: Mouse monoclonal to Bid

anti-Bid (21F10)

LF-MA0208 100 ul
EUR 334.00
Description: Mouse monoclonal to Bid

anti-BID (3C5)

LF-MA30561 100 ul
EUR 527.00
Description: Mouse Monoclonal to BID

Anti-Bid Antibody

PB9027 100ug/vial
EUR 334.00

Anti-Bid Antibody

PA2015 100ug/vial
EUR 334.00

Recombinant mouse BID

P1006 100ug Ask for price
  • Uniprot ID: P70444
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse BID

Anti-BID antibody

PAab00892 100 ug
EUR 355.00

pcDNA3.1-BID Plasmid

PVTB00401-2a 2 ug
EUR 356.00

Anti-BID antibody

STJ97864 100 µl
EUR 234.00
Description: Mouse monoclonal to BID.

Anti-BID antibody

STJ91853 200 µl
EUR 197.00
Description: Rabbit polyclonal to BID.

Anti-Bid antibody

STJ22797 100 µl
EUR 277.00
Description: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined.

Anti-BID antibody

STJ90016 200 µl
EUR 197.00
Description: Rabbit polyclonal to BID.

Anti-BID antibody

STJ70684 100 µg
EUR 359.00

Anti-BID antibody

STJ111018 100 µl
EUR 277.00
Description: This gene encodes a death agonist that heterodimerizes with either agonist BAX or antagonist BCL2. The encoded protein is a member of the BCL-2 family of cell death regulators. It is a mediator of mitochondrial damage induced by caspase-8 (CASP8); CASP8 cleaves this encoded protein, and the COOH-terminal part translocates to mitochondria where it triggers cytochrome c release. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined.

Rat BID shRNA Plasmid

20-abx986315
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BID Antibody, HRP conjugated

1-CSB-PA002698HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BID Antibody, FITC conjugated

1-CSB-PA002698HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BID Antibody, Biotin conjugated

1-CSB-PA002698HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BID. Recognizes BID from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-BID (S78) Antibody

1-CSB-PA040302
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BID (S78). Recognizes Phospho-BID (S78) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

Bid recombinant monoclonal antibody

A5293 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Bid for WB, IHC,ELISA

Mouse BID shRNA Plasmid

20-abx969354
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BID shRNA Plasmid

20-abx950433
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-BID (Ser78) Antibody

A1152-100
EUR 403.00

Sheep Bid ELISA Kit

ESB0313 96Tests
EUR 521.00

Mouse Bid ELISA Kit

EMB0313 96Tests
EUR 521.00

Results. Analysis of the results showed that a complete cure ulcer was achieved in 35% of patients treated with radial shockwave, 26% of patients with focused shock waves used