Healy, Katherine, Alain B. Labrique, J. Jaime Miranda, Robert H. Gilman, David Danz, Victor G. Davila-Roman, Luis Huicho, Fabiola León-Velarde, and William Checkley. dark adaptation at high altitude: Unexpected pupillary response to chronic hypoxia in the Andean highlands. High Alt Med Biol. 17: 208-213 mountain sickness, chronic-2016 is a maladaptive response to the high altitude (> 2500 m above sea level) and is characterized by excessive erythrocytosis and hypoxemia resulting from long-term hypobaric hypoxia.

No known early predictor of chronic mountain sickness and the diagnosis is based on the presence of excessive erythrocytosis and clinical features. Impaired dark adaptation, or the inability to visually adjust from high to low-light settings, occurs in response to mild hypoxia and can serve as an early predictor of hypoxemia and chronic mountain sickness. We aimed to evaluate the relationship between pupillary response assessed by adaptometry dark and daytime hypoxemia high Andean population aged ≥35 years living in Puno, Peru. Oxyhemoglobin saturation (SpO2) were recorded using a handheld pulse oximeter.

Quantitative dark adaptation as the magnitude of contraction of the pupil to light stimuli of various intensities (-2.9 to 0.1 log cd / m2) using a portable dark adaptometer. multilevel analysis of individual and specific stimulus done using mixed-effects models to obtain the relationship between SpO2 and responsive pupil. Among the 93 participants, the mean age was 54.9 ± 11.0 years, 48% were male, 44% are night blind, and the average SpO2 was 89.3% ± 3.4%.

The amount of contraction of the pupil is greater with lower SpO2 (p <0.01), and this relationship remained significant doses in some variables analysis (p = 0.047). The pupils are responsive to light stimulation under dark-adapted conditions exaggerated by hypoxemia and can serve as an early predictor of chronic mountain sickness. This unexpected associations potentially described as a sympathetic response excessive and unregulated hypoxemia at high altitude.

 Dark Adaptation at High Altitude: An Unexpected Pupillary Response to Chronic Hypoxia in Andean Highlanders.
Dark Adaptation at High Altitude: An Unexpected Pupillary Response to Chronic Hypoxia in Andean Highlanders.

The difference between the Lesbian, Gay, Bisexual, Heterosexual Individuals, and those who reported other Identity in Open-Ended Response Level of Social Anxiety.

Previous research suggests that individuals with marginal level report higher sexual orientation of emotional distress (Cochran, 2001; Mayer, 2003), including a higher prevalence of social anxiety (Gilman et al, 2001 ;. Potoczniak, Aldea, & DeBlaere, 2007; Safren & Pantalone, 2006) compared to heterosexuals.

This research builds on previous research by examining the results on the identity of sexual minorities, including additional write-in response options. One hundred and eighty people participating in the online study in which they indicate their sexual orientation and completed measures of social anxiety.

The results showed that in a sample recruited in liberal urban population, lesbian / gay and heterosexual people rated the same level of social anxiety in four Liebowitz Social Anxiety Scale subscales (fear, avoidance, social, and performance; Liebowitz, 1987). Or, people who identified as bisexual, or indicate write-in sexual orientation rated significantly higher levels of social anxiety than heterosexual and lesbian groups / gay.

Human Adenylate Kinase 3 (AK3) ELISA Kit

RD-AK3-Hu-48Tests 48 Tests
EUR 521

Human Adenylate Kinase 3 (AK3) ELISA Kit

RD-AK3-Hu-96Tests 96 Tests
EUR 723

Human Adenylate Kinase 3 (AK3) ELISA Kit

RDR-AK3-Hu-48Tests 48 Tests
EUR 544

Human Adenylate Kinase 3 (AK3) ELISA Kit

RDR-AK3-Hu-96Tests 96 Tests
EUR 756

Ak3/ Rat Ak3 ELISA Kit

ELI-38174r 96 Tests
EUR 886

GTP:AMP Phosphotransferase AK3, Mitochondrial (AK3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

GTP:AMP Phosphotransferase AK3, Mitochondrial (AK3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AK3 antibody

70R-5874 50 ug
EUR 467
Description: Rabbit polyclonal AK3 antibody raised against the N terminal of AK3

AK3 antibody

10R-1020 100 ul
EUR 375
Description: Mouse monoclonal AK3 antibody

AK3 antibody

10R-3231 100 ul
EUR 691
Description: Mouse monoclonal AK3 antibody

AK3 antibody

10R-3232 100 ul
EUR 691
Description: Mouse monoclonal AK3 antibody

AK3 antibody

10R-3233 100 ul
EUR 726
Description: Mouse monoclonal AK3 antibody

AK3 antibody

10R-3235 100 ul
EUR 691
Description: Mouse monoclonal AK3 antibody

AK3 antibody

10R-3236 100 ul
EUR 691
Description: Mouse monoclonal AK3 antibody

AK3 antibody

10R-3237 100 ul
EUR 691
Description: Mouse monoclonal AK3 antibody

AK3 antibody

70R-15645 50 ul
EUR 435
Description: Rabbit polyclonal AK3 antibody

AK3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK3. Recognizes AK3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

AK3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against AK3. Recognizes AK3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


YF-PA18748 50 ul
EUR 363
Description: Mouse polyclonal to AK3


YF-PA18749 50 ug
EUR 363
Description: Mouse polyclonal to AK3


YF-PA18750 100 ul
EUR 403
Description: Rabbit polyclonal to AK3


YF-PA18751 100 ug
EUR 403
Description: Rabbit polyclonal to AK3


YF-PA26120 50 ul
EUR 334
Description: Mouse polyclonal to AK3

GTP:AMP Phosphotransferase AK3, Mitochondrial (AK3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GTP:AMP Phosphotransferase AK3, Mitochondrial (AK3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GTP:AMP Phosphotransferase AK3, Mitochondrial (AK3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- AK3 antibody

FNab00246 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-2000
  • IHC: 1:20-200
  • Immunogen: adenylate kinase 3
  • Uniprot ID: Q9UIJ7
  • Gene ID: 50808
  • Research Area: Metabolism
Description: Antibody raised against AK3

AK3 Rabbit pAb

A4694-100ul 100 ul
EUR 308

AK3 Rabbit pAb

A4694-200ul 200 ul
EUR 459

AK3 Rabbit pAb

A4694-20ul 20 ul
EUR 183

AK3 Rabbit pAb

A4694-50ul 50 ul
EUR 223

AK3 Blocking Peptide

33R-6011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of AK3 antibody, catalog no. 70R-5874

AK3 Polyclonal Antibody

30599-100ul 100ul
EUR 252

AK3 Polyclonal Antibody

30599-50ul 50ul
EUR 187

AK3 cloning plasmid

CSB-CL883438HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 684
  • Sequence: atgggggcgtccgcgcggctgctgcgagcggtgatcatgggggccccgggctcgggcaagggcaccgtgtcgtcgcgcatcactacacacttcgagctgaagcacctctccagcggggacctgctccgggacaacatgctgcggggcacagaaattggcgtgttagccaaggcttt
  • Show more
Description: A cloning plasmid for the AK3 gene.

Anti-AK3 antibody

PAab00246 100 ug
EUR 355

anti-AK3 (1D2)

LF-MA10012 100 ug
EUR 363
Description: Mouse monoclonal to AK3

anti-Ak3 (6E10)

LF-MA10013 100 ug
EUR 363
Description: Mouse monoclonal to Ak3


PVT13826 2 ug
EUR 391

Anti-AK3 antibody

STJ116255 100 µl
EUR 277
Description: The protein encoded by this gene is a GTP:ATP phosphotransferase that is found in the mitochondrial matrix. Several transcript variants encoding a few different isoforms have been found for this gene.

AK3 Polyclonal Conjugated Antibody

C30599 100ul
EUR 397

Mouse AK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat AK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF007678 96 Tests
EUR 689

Human AK3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AK3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK3. Recognizes AK3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AK3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK3. Recognizes AK3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AK3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AK3. Recognizes AK3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

AK3 Recombinant Protein (Human)

RP000859 100 ug Ask for price

AK3 Recombinant Protein (Rat)

RP189674 100 ug Ask for price

AK3 Recombinant Protein (Mouse)

RP115100 100 ug Ask for price

Adenylate Kinase 3 (AK3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Adenylate Kinase 3 (AK3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Adenylate Kinase 3 (AK3) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Adenylate Kinase 3 (AK3) Antibody

abx033891-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Adenylate Kinase 3 (AK3) Antibody

abx033891-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Adenylate Kinase 3 (AK3) Antibody

abx230246-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human GTP:AMP phosphotransferase, mitochondrial (AK3)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human GTP:AMP phosphotransferase, mitochondrial(AK3) expressed in E.coli

AK3 ORF Vector (Human) (pORF)

ORF000287 1.0 ug DNA
EUR 95

h AK3 inducible lentiviral particles

LVP031 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, AK3, is fully sequence verified and matched to NCBI accession ID: NM_013410.2

Ak3 ORF Vector (Mouse) (pORF)

ORF038368 1.0 ug DNA
EUR 506

Ak3 ORF Vector (Rat) (pORF)

ORF063226 1.0 ug DNA
EUR 506

Recombinant Adenylate Kinase 3 (AK3)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9UIJ7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 28.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Adenylate Kinase 3 expressed in: E.coli

AK3 ELISA Kit (Human) (OKCD00960)

OKCD00960 96 Wells
EUR 831
Description: Description of target: Involved in maintaining the homeostasis of cellular nucleotides by catalyzing the interconversion of nucleoside phosphates. Has GTP:AMP phosphotransferase and ITP:AMP phosphotransferase activities.UniRule annotation <p>Manual validated information which has been generated by the UniProtKB automatic annotation system.</p> <p><a href="/manual/evidences#ECO:0000255">More…</a></p> Manual assertion according to rulesiHAMAP-Rule:MF_031691 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Structure and expression of human mitochondrial adenylate kinase targeted to the mitochondrial matrix."_x005F_x005F_x000D_Noma T., Fujisawa K., Yamashiro Y., Shinohara M., Nakazawa A., Gondo T., Ishihara T., Yoshinobu K._x005F_x005F_x000D_Biochem. J. 358:225-232(2001) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), FUNCTION, CATALYTIC ACTIVITY, TISSUE SPECIFICITY, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.146 ng/mL

Polyclonal AK3 Antibody (C-term H38)

APG01642G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AK3 (C-term H38). This antibody is tested and proven to work in the following applications:

Polyclonal Ak3 antibody - C-terminal region

APR14890G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ak3 - C-terminal region. This antibody is tested and proven to work in the following applications:

AK3 sgRNA CRISPR Lentivector set (Human)

K0064701 3 x 1.0 ug
EUR 339

Human Adenylate Kinase 3 (AK3) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Ak3 sgRNA CRISPR Lentivector set (Mouse)

K3561801 3 x 1.0 ug
EUR 339

Ak3 sgRNA CRISPR Lentivector set (Rat)

K7607701 3 x 1.0 ug
EUR 339

Recombinant human GTP:AMP phosphotransferase AK3, mitochondrial 

P1626 100ug Ask for price
  • Uniprot ID: Q9UIJ7
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human GTP:AMP phosphotransferase AK3, mitochondrial 

Mouse Adenylate Kinase 3 (AK3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse GTP:AMP phosphotransferase, mitochondrial, Ak3 ELISA KIT

ELI-21275m 96 Tests
EUR 865

AK3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0064702 1.0 ug DNA
EUR 154

AK3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0064703 1.0 ug DNA
EUR 154

AK3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0064704 1.0 ug DNA
EUR 154

Human GTP:AMP phosphotransferase, mitochondrial, AK3 ELISA KIT

ELI-44141h 96 Tests
EUR 824

Bovine GTP:AMP phosphotransferase, mitochondrial, AK3 ELISA KIT

ELI-38173b 96 Tests
EUR 928

Human Adenylate Kinase 3 (AK3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Adenylate Kinase 3 (AK3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Ak3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3561802 1.0 ug DNA
EUR 154

Ak3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3561803 1.0 ug DNA
EUR 154

Ak3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3561804 1.0 ug DNA
EUR 154

Ak3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7607702 1.0 ug DNA
EUR 154

Ak3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7607703 1.0 ug DNA
EUR 154

Ak3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7607704 1.0 ug DNA
EUR 154

AK3 Protein Vector (Human) (pPB-C-His)

PV001145 500 ng
EUR 329

AK3 Protein Vector (Human) (pPB-N-His)

PV001146 500 ng
EUR 329

AK3 Protein Vector (Human) (pPM-C-HA)

PV001147 500 ng
EUR 329

AK3 Protein Vector (Human) (pPM-C-His)

PV001148 500 ng
EUR 329

Human Adenylate Kinase 3(AK3)ELISA Kit

QY-E00860 96T
EUR 361

AK3 Protein Vector (Human) (pPB-His-MBP)

PV320822 500 ng
EUR 329

AK3 Protein Vector (Human) (pPB-His-GST)

PV320823 500 ng
EUR 329

AK3 Protein Vector (Mouse) (pPB-C-His)

PV153470 500 ng
EUR 603

AK3 Protein Vector (Mouse) (pPB-N-His)

PV153471 500 ng
EUR 603

AK3 Protein Vector (Mouse) (pPM-C-HA)

PV153472 500 ng
EUR 603

AK3 Protein Vector (Mouse) (pPM-C-His)

PV153473 500 ng
EUR 603

AK3 Protein Vector (Rat) (pPB-C-His)

PV252902 500 ng
EUR 603

AK3 Protein Vector (Rat) (pPB-N-His)

PV252903 500 ng
EUR 603

AK3 Protein Vector (Rat) (pPM-C-HA)

PV252904 500 ng
EUR 603

AK3 Protein Vector (Rat) (pPM-C-His)

PV252905 500 ng
EUR 603

Ak3 3'UTR Luciferase Stable Cell Line

TU200443 1.0 ml Ask for price

Ak3 3'UTR GFP Stable Cell Line

TU151603 1.0 ml Ask for price

Human Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenylate Kinase 3 (AK3) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenylate Kinase 3 (AK3) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenylate Kinase 3 (AK3) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Adenylate Kinase 3 (AK3) in serum, plasma, cerebrospinal fluid and other biological fluids.

Human Adenylate Kinase 3 (AK3) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adenylate Kinase 3 elisa. Alternative names of the recognized antigen: AK3L1
  • AK6
  • AKL3L
  • Adenylate Kinase 3 Alpha-Like 1
  • GTP:AMP Phosphotransferase AK3, Mitochondrial
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Adenylate Kinase 3 (AK3) in samples from Serum, plasma, cerebrospinal fluid and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adenylate Kinase 3 (AK3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adenylate Kinase 3 (AK3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adenylate Kinase 3 (AK3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Adenylate Kinase 3 (AK3) ELISA Kit

SEF205Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Adenylate Kinase 3 (AK3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Adenylate Kinase 3 (AK3) in tissue homogenates, cell lysates and other biological fluids.

Mouse Adenylate Kinase 3 (AK3) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Adenylate Kinase 3 elisa. Alternative names of the recognized antigen: AK3L1
  • AK6
  • AKL3L
  • Adenylate Kinase 3 Alpha-Like 1
  • GTP:AMP Phosphotransferase AK3, Mitochondrial
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Adenylate Kinase 3 (AK3) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

AK3 3'UTR Luciferase Stable Cell Line

TU000537 1.0 ml
EUR 4617

Ak3 3'UTR Luciferase Stable Cell Line

TU101603 1.0 ml Ask for price

AK3 3'UTR GFP Stable Cell Line

TU050537 1.0 ml
EUR 4617

Ak3 3'UTR GFP Stable Cell Line

TU250443 1.0 ml Ask for price

ELISA kit for Human AK3 (Adenylate Kinase 3)

ELK4122 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Adenylate Kinase 3 (AK3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Adenylate
  • Show more
Description: A sandwich ELISA kit for detection of Adenylate Kinase 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

AK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV673591 1.0 ug DNA
EUR 514

AK3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV673595 1.0 ug DNA
EUR 514

AK3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV673596 1.0 ug DNA
EUR 514

ELISA kit for Human GTP:AMP phosphotransferase, mitochondrial (AK3)

KTE60637-48T 48T
EUR 332
  • The deduced 227-amino acid protein has a calculated molecular mass of 25.6 kD. AK3 shares 57.4% amino acid identity with AK4 (AK3L1). It shares 75%, 90%, and 91% amino acid identity with bovine, rat, and mouse Ak3, respectively. Northern blot analysi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human GTP:AMP phosphotransferase, mitochondrial (AK3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human GTP:AMP phosphotransferase, mitochondrial (AK3)

KTE60637-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The deduced 227-amino acid protein has a calculated molecular mass of 25.6 kD. AK3 shares 57.4% amino acid identity with AK4 (AK3L1). It shares 75%, 90%, and 91% amino acid identity with bovine, rat, and mouse Ak3, respectively. Northern blot analysi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human GTP:AMP phosphotransferase, mitochondrial (AK3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human GTP:AMP phosphotransferase, mitochondrial (AK3)

KTE60637-96T 96T
EUR 539
  • The deduced 227-amino acid protein has a calculated molecular mass of 25.6 kD. AK3 shares 57.4% amino acid identity with AK4 (AK3L1). It shares 75%, 90%, and 91% amino acid identity with bovine, rat, and mouse Ak3, respectively. Northern blot analysi
  • Show more
Description: Quantitative sandwich ELISA for measuring Human GTP:AMP phosphotransferase, mitochondrial (AK3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3)

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3). This antibody is labeled with APC.

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3). This antibody is labeled with Biotin.

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3). This antibody is labeled with Cy3.

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3). This antibody is labeled with FITC.

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3). This antibody is labeled with HRP.

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3). This antibody is labeled with PE.

AK3 Protein Vector (Human) (pPM-N-D-C-HA)

PV320824 500 ng
EUR 552

AK3 Protein Vector (Human) (pPM-N-D-C-His)

PV320825 500 ng
EUR 552

AK3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0064705 3 x 1.0 ug
EUR 376

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3561805 3 x 1.0 ug
EUR 376

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7607705 3 x 1.0 ug
EUR 376

Adenylate Kinase 3 (AK3) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: AK3 (Leu8~Pro227)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Adenylate Kinase 3 (AK3). This antibody is labeled with APC-Cy7.

AK3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0064706 1.0 ug DNA
EUR 167

AK3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0064707 1.0 ug DNA
EUR 167

AK3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0064708 1.0 ug DNA
EUR 167

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3561806 1.0 ug DNA
EUR 167

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3561807 1.0 ug DNA
EUR 167

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3561808 1.0 ug DNA
EUR 167

AK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV673592 1.0 ug DNA
EUR 514

AK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV673593 1.0 ug DNA
EUR 572

AK3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV673594 1.0 ug DNA
EUR 572

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7607706 1.0 ug DNA
EUR 167

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7607707 1.0 ug DNA
EUR 167

Ak3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7607708 1.0 ug DNA
EUR 167

The findings highlight the importance of offering write-in selection of sexual identity, as well as see the difference between the experience of sexual minority groups in all. Future studies should investigate the potential group differences in social anxiety throughout sexual orientation in a larger sample so that comparisons can be made between subgroups of group write-in responses, as well as investigating the potential contributors to the group differences.